Atom Scientific Sds

Lab Reagents

Atom Scientific Stains Laboratories manufactures the atom scientific sds reagents distributed by Genprice. The Atom Scientific Sds reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Atom Scientific Stains. Other Atom products are available in stock. Specificity: Atom Category: Scientific Group: Sds

Sds information


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

10% SDS

TG4060 1ml
EUR 134


YF-PA17352 50 ug
EUR 363
Description: Mouse polyclonal to SDS

dAbs scaffold protein anti-Human B5R

SDS-L073 1 mg
EUR 4496
Description: Scaffold protein

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution

A0030 4L
EUR 94.8
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TT-SDS (Tris-Tricine-SDS buffer) Premix powder

TD8135 1PK, 10L
EUR 76.1
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4

UA0030 500ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS Polyclonal Antibody

27842-100ul 100ul
EUR 252

SDS Polyclonal Antibody

27842-50ul 50ul
EUR 187

SDS Rabbit pAb

A12898-100ul 100 ul
EUR 308

SDS Rabbit pAb

A12898-200ul 200 ul
EUR 459

SDS Rabbit pAb

A12898-20ul 20 ul
EUR 183

SDS Rabbit pAb

A12898-50ul 50 ul
EUR 223

SDS Blocking Peptide

33R-4446 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide

33R-1011 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS cloning plasmid

CSB-CL020926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
  • Show more
Description: A cloning plasmid for the SDS gene.

101Bio SDS-Remover